@towritebystarlight

anxietyproblem:

Me and my friend

galaxybrainthot :

my sexuality is now officially the hot badass lady from mortal engines

kieren-fucking-walker :

A collection of posts with advice for getting you and your blog through whatever this mess is.

Check if your blog has been incorrectly flagged as NSFW (and if it has, get it unflagged before Dec 17th)

See all your blog posts that have been flagged (because tumblr didn’t feel the need to notify you?)

New posts not showing up on your blog and how to fix it (you have not been muted)

Exporting your blog (Tumblr)

Backing up your blog (to WordPress)

Alternative way to backup your blog

Masterpost of Tumblr alternatives

Complaining to Tumblr about this mess

Advice for those who’ve never dealt with a fandom purge before

All of these posts link back to original posts of other blogs, I mostly made this for myself but decided to make it shareable, please respect the following:

If you click through to ANY of these posts, even if you don’t use them, reblog them individually if you’re going to like/reblog this post. 

Share and add to this post if you can <3

ellibeanz :

lovesexandhumor :

xavea :

solarpunkarchivist :

death-limes :

coelasquid :

This whole “trust Tumblr blindly” thing is eventually going to kill someone, as I became pointedly aware of on one occasion I was making fun of how poorly a particular bleach-based drain declogger was working on my sink and got a chorus of really dangerously misinformed people telling me to pour vinegar in after it because all cute little cool kid diy home care blogs they’re following talk about vinegar like it it’s the big secret the cleaning companies don’t want you to know.

And I cringed knowing that someday, some Well Actually expert who read a blog article once is going to give that advice to someone who unfortunately didn’t take high school chemistry and isn’t aware that MIXING VINEGAR AND BLEACH MAKES CHLORINE GAS.

holy fucking jesus tits reblog to save a life

OK I actually got a full on A* for GCSE Chemistry and if I ever knew this I’ve forgotten it. Seriously reblog this.

Also don’t use bleach to clean up if your cat pees outside the littlerbox (or urine in general for that matter, species doesn’t really matter here I think). I did that in a small space and it took me a bit of coughing and wheezing and wanting to tear my eyes out before I went, “wait, fuck, I just gassed myself”.

Be aware of the chemicals you are using even if they are natural cleaners.

16 Common Product Combinations You Should Never Mix

faunigraphic :

cloudbrah :

fuckin high schoolers in productions of Hair or Rent do gay kisses at age 16 grow the fuck up ben

quite-likely-valentine :

I know there’s a lot of tension after Tumblr’s new policy annouced for December 17th, but reblog this if you aren’t leaving Tumblr so that other blogs can know they aren’t going to be completely alone!

bishopl :

Deadpool *liked*

animatedamerican :

samstiels :

The easiest method

• Go to a postlimit checker
  
• Enter your blog url
• If you’ve been flagged as explicit, under General Blog Info your url will be listed as [nsfw] and your avatar will be pixelated 

Without leaving you blog

• Go to settings
  
• Select your blog from the bar on the right
• Go down to the On-Blog Advertising section
• If the On-Blog Advertising button is normal and allows you click it on or off, then you’re fine
• If the On-Blog Advertising is off, faded, and you can’t click it on or off, then you’ve been flagged as explicit

Not explicit

Explicit

this strikes me as useful to know

ava-riel :

axolotl fae dragon familiar ;-D

i-rather-be-lost :

anarkisses :

Jesus

This is so satisfying to watch

a-walkingmeme :

thecommonchick :

isabellesutra :

chamiryokuroi :

chamiryokuroi :

chamiryokuroi :

chamiryokuroi :

I will be participating on a guacamole contest tomorrow at work. My objective is not to win, but to make every single one of the judges cry.

I will add every single chili I am able to find at the store, all of them.

All the chilis I could find at the store… i wonder if it will be enough :P

Ready for the judges!!

So updates after the contest! I didn’t win.

This guacamole had the talent that when you take the first bite of your chip it isnt that spicy, but after a few seconds the feeling starts to spread. The judges bravely took a bite and were all happy and as I walked away from the table they started to gasp when the full force of the 6 different types of chili hit them at once.

People were free to taste it afterwards and every face of first surprise and then pain filled my heart with happiness.

I have never seen so much people enjoy suffering tho, because they finished everything so fast I even got time to make a second batch before the winners were announced.

Overall this was great and I had lots of fun making others suffer :D

this? innocent sadism. i aspire to be like this

just-shower-thoughts :

If, according to Kanye West, one good girl is worth a thousand bitches, and if, according to Lil’ Wayne, bitches come a dime a dozen, that means one good girl is worth $8.33 (USD).

deepspacepirate :

deepspacepirate :

monkeysky :

intranet :

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

You got like six unique nucleotides so nice

OP is a virus from outer space

FUCK YOU OP

napoleanbonafarte :

markv5 :

Потому что в этом доме только одна звезда…

“Because in this house there’s only one star”

sleepwalkingdragon :

actual-dalish-mastermind :

dancinginthecenteroftheworld :

when-in-doubt-sing :

millennial-review :

I was waiting for the night bus at 1am the other night, eating fries, when a dude, high as fuck, tried to harass me. It took several “I don’t want to talk to you, please go away” for him to finally move, but I think it helped that another man was giving him the death stare and clicking his tongue at him. He then checked I was okay and whether I knew the guy or not. Good dude.

Shout out also the man who silently switched places with me on another night bus to be a buffer between me and a guy who had threatened me. Thank you

Men: this here? This here is what you need to be doing as allies. The men who harass and insult women are not likely to take our complaints about it seriously. But you, another man, they will listen to. 

I was pumping gas at like 10 PM one night, and these bunch of drunk guys came walking up to the gas station, and one of them yelled over to me if I wanted to see his dick.  His friend says to him, “You don’t have anything she wants to see.” and apologized.  It was pretty awesome.

this is all we want from men. to recognize the wrongs done by other men, and acknowledge it. not give us shitass defense like, “not all men do that”

ao3tagoftheday :

bismuth-209 :

ao3tagoftheday :

[Image Description: Tag reading “rip in piss sizzle tits”]

The AO3 Tag of the Day is: George H. W. Bush (June 12, 1924 – November 30, 2018)

It is probably terrible that I found out about his death through this post

This is the greatest thing that has ever happened on my blog

legitimatelala :

queenstravelingdarling :

thoughtremixer :

blackgiornogiovanna :

ellsworthej :

quasmellito :

baiganchokah :

hallaisme247 :

hi-imkingdavid :

brattynympho :

lordespino :

candiikismet :

darkislovelyyyy :

This shit is still funny

Lmao what the hell!

Lmfao fuck that’s me

Why was he in jail?

@illmaticraj right now

Yeah I wanna know what he did cuz in all honesty if he r*ped this girl I don’t wanna be supporting him and shit by reblogging

Facts

Nah he sold some weed to a undercover and used this as a pickup line

Ok in that case lmfaoooooooo

Just to put some context into this:

Let him go 😂😂😂😂😂

The finger guns at the end just slay me 😂

monobored :

demoncest:

merry christmas 

Tumblr algorithm:

dare-i-say-asexual :

dare-i-say-asexual :

dare-i-say-asexual :

i just walked past the apartment beneath mine and through an open window i could hear my downstairs neighbor crying faintly while the song jolene played in the background and im just like… bitch are you okay…?

I actually ended up going back downstairs to check on her and brought some leftover cookies I baked this afternoon. she’s very sweet and going through a Breakup Mood™️ after being cheated on. she’s coming over to my gf and I’s annual bad movie night on Friday and she even let me pet her cat named Clarence

my gf thinks it’s funny but very fitting that our downstairs neighbor was able to summon a concerned lesbian just by playing jolene while crying about being done dirty by a man

llamaavocado :

nthn27 :

I thought this was funnier than I should have

@1m4l0st8oy

slyfox101honk :

swolerbear :

k-lionheart :

Reblog if you’re a petticoated swashbuckler and would stab a man with a hairpin

honestly I love history that reminds us that the assholes of today are exactly like the assholes of yesteryear

Hell yeah I’d stab a man(other than my boyfriend) who gets grabby on me. I carry around a pocket knife for a reason

yesterdaysprint :

The Stark County Democrat, Canton, Ohio, April 9, 1901

ana-logical :

ask-anxietyhorrorborn :

galaxypokemon06 :

alivingfandomreference :

secondlina:

the-crystal-queen:

strangenewclassrooms:

pencilblots:

maryburgers:

maryburgers:

riskpig:

luthienebonyx:

telanu:

britney2007spears:

hoodoo-hoodlum:

I’m so mad because this worked

help me roger

Reblogging myself because

Originally posted by gifs-for-the-masses

Reblogging myself because… what was that? Five minutes?

O_O

………my friend has made me curious

help me roger

Update: after I reblogged this someone messaged me offering me tickets to the sold out Hausu screening with a Q&A and autograph session with the director

These never work for me, but here’s to trying.

1. I don’t believe in these things
   
2. But last time I reblogged one ten/fifteen minutes later I got a call offering me a job
3. But I reblogged it because I was waiting on hearing back from the job. So there you go.
4. Roger is cute.

Eh Roger is cute I might as well

That fish is so happy it makes me happy.

I have no luck right now. Halp.

Why does this have so many notes

because its not one of your posts.

Roger is precious to me.

cousinnick:

latenightalaska:

davereziplease:

dietchola:

JESUS CHRIST

“I’m a horrible father”

THE BEST PART IS THE GIRL IN THE MIDDLE JUST SO DONE

AND THE FACT THAT THIS FAMILY IS MORE MULTI CULTURAL THAN A PUBLIC SCHOOL HEALTH CLASS TEXTBOOK

The girl in the middle is just like “Damn it, Dad.”